Characterization of two outer membrane protein antigens of Porphyromonas gingivalis that are protective in a murine lesion model.

Porphyromonas gingivalis is a key periodontal pathogen that has been implicated in the aetiology of chronic adult periodontitis. The aim of this study was to characterize two potential vaccine candidates (PG32 and PG33) identified from a previous genomic sequence analysis. Gene knockout studies suggested that these proteins play an important role in bacterial growth and are transcriptionally linked. Analysis of 14 laboratory and clinical isolates of P. gingivalis found that in all strains, both genes were present with a high level of conservation and that the two proteins were also expressed in vitro. Truncated recombinant PG32 and PG33 proteins were produced in Escherichia coli in an attempt to increase the solubility of the proteins while retaining their native conformation. While most of the truncated proteins remained insoluble, two truncated proteins showed good solubility and high levels of protection in the P. gingivalis murine lesion model and may be considered as potential vaccine candidates for further testing in models of human periodontal disease.

Identification of vaccine candidate antigens from a genomic analysis of Porphyromonas gingivalis.

Porphyromonas gingivalis is a key periodontal pathogen which has been implicated in the etiology of chronic adult periodontitis. Our aim was to develop a protein based vaccine for the prevention and or treatment of this disease. We used a whole genome sequencing approach to identify potential vaccine candidates. From a genomic sequence, we selected 120 genes using a series of bioinformatics methods. The selected genes were cloned for expression in Escherichia coli and screened with P. gingivalis antisera before purification and testing in an animal model. Two of these recombinant proteins (PG32 and PG33) demonstrated significant protection in the animal model, while a number were reactive with various antisera. This process allows the rapid identification of vaccine candidates from genomic data.

A simple PCR method for rapid genotype analysis of Mycobacterium ulcerans.

Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype.

Identification and characterization of IS2404 and IS2606: two distinct repeated sequences for detection of Mycobacterium ulcerans by PCR.

Molecular analysis of Mycobacterium ulcerans has revealed two new insertion sequences (ISs), IS2404 and IS2606. IS2404 was identified by complete sequencing of a previously described repetitive DNA segment from M. ulcerans. This element is 1,274 bp long, contains 12-bp inverted repeats and a single open reading frame (ORF) potentially encoding a protein of 327 amino acids (aa), and apparently generates 7-bp direct repeats upon transposition. Amino acid similarity was found between the putative transposase and those encoded by ISs in other bacterial sequences from Aeromonas salmonicida (AsIs1), Escherichia coli (H repeat element), Vibrio cholerae (VcIS1), and Porphyromonas gingivalis (PGIS2). The second IS, IS2606, was discovered by sequence analysis of a HaeIII fragment of M. ulcerans genomic DNA containing a repetitive sequence. This element is 1,404 bp long, with 12-bp inverted repeats and a single ORF potentially encoding a protein of 445 aa. Database searches revealed a high degree of amino acid identity (70%) with the putative transposase of IS1554 from M. tuberculosis. Significant amino acid identity (40%) was also observed with transposases from several other microorganisms, including Rhizobium meliloti (ISRm3), Burkholderia cepacia (IS1356), Corynebacterium diphtheriae, and Yersinia pestis. PCR screening of DNA from 45 other species of mycobacteria with primers for IS2404 confirm that this element is found only in M. ulcerans. However, by PCR, IS2606 was also found in Mycobacterium lentiflavum, another slow-growing member of the genus Mycobacterium that is apparently genetically distinct from M. ulcerans. Testing the sensitivity of PCR based on IS2404 and IS2606 primers demonstrated the ability to detect 0.1 and 1 M. ulcerans genome equivalents, respectively. The ability to detect small numbers of cells by using two gene targets will be particularly useful for analyzing environmental samples, where there may be low concentrations of M. ulcerans among large numbers of other environmental mycobacteria.

5,5-trans lactone-containing inhibitors of serine proteases: identification of a novel, acylating thrombin inhibitor.

Synthesis of a variety of 5,5-trans fused lactones, related to compounds found in extracts of Lantana camara, has provided a series of novel acylating inhibitors of human thrombin, trypsin, chymotrypsin and human leucocyte elastase. The most effective thrombin inhibitor is 7 with an IC50 of 130 nM and a Kobs/[1] of 4,000 M-1 s-1.

Detection of Mycobacterium ulcerans in environmental samples during an outbreak of ulcerative disease.

Mycobacterium ulcerans is an environmental bacterium which causes chronic skin ulcers. Despite significant epidemiological evidence to suggest that water is the source of infection, the organism has never been identified in the environment. Environmental water samples were collected from a small town in which an outbreak of 29 cases had occurred in a 3-year period. These were examined by mycobacterial culture and PCR amplification. Similar to previous studies, M. ulcerans was not cultured from the water samples. However, five samples were positive for M. ulcerans by PCR. These samples were collected from a swamp and a golf course irrigation system within the outbreak area. This is the first time that M. ulcerans has been demonstrated to be present in the environment and supports the postulated epidemiology of disease due to this organism.

Development of a PCR assay for rapid diagnosis of Mycobacterium ulcerans infection.

The diagnosis of Mycobacterium ulcerans infection is hampered by the slow growth of the bacterium in culture, resulting in a delay of several months before a specific diagnosis can be obtained. In addition, M. ulcerans cannot be isolated from water even when there is convincing epidemiological evidence implicating this as the source of infection. The aim of the present study was to develop a PCR assay to circumvent the problems of delayed diagnosis and insensitivity of standard bacterial culture for M. ulcerans. For the PCR, we isolated an M. ulcerans-specific DNA fragment, 1,109 bp long, which is repeated at least 50 times throughout the genome. Use of this sequence as a target for PCR allowed us to detect as few as 2 molecules of genomic DNA in vitro. The PCR was used to detect M. ulcerans DNA in fresh tissue and paraffin-embedded sections from all seven patients with culture-confirmed cases of infection.

Chronic meningitis due to herpes simplex virus in an immunocompetent host.

Herpes simplex virus (HSV) typically causes mucocutaneous disease, encephalitis, and acute men ingitis. There have been no previous reports of chronic meningitis due to this virus. A case of chronic meningitis due to herpes simplex virus type 2 (HSV-2) in a previously healthy 35-year-old woman whose predominant symptoms were headache and meningism without fever is described. Analysis of cerebrospinal fluid (CSF) revealed a lymphocytic pleocytosis, elevated protein, and hypoglycorrhachia. The diagnosis of herpes simplex meningitis was supported by the detection of HSV-2 DNA in CSF by polymerase chain reaction and by intrathecal production of HSV-specific antibody. The patient recovered after treatment with intravenous acyclovir and glucocorticoids.

Candida albicans: a review of its history, taxonomy, epidemiology, virulence attributes, and methods of strain differentiation.

The dimorphic yeast Candida albicans has been recognized as an increasingly important human pathogen particularly in immunocompromised hosts because of advanced age, infection or immunosuppressive therapy. This review outlines the history, taxonomy and epidemiology of this medically important yeast as well as discussing some of characteristics which are purported to be related to its virulence. Methods utilized for strain differentiation in the study of the epidemiologic relationship of members of this species are discussed.

The squalestatins: decarboxy and 4-deoxy analogues as potent squalene synthase inhibitors.

Squalestatins without either the hydroxy group at C-4 or the carboxylic acid at C-3 or C-4 were prepared and evaluated for their ability to inhibit rat liver microsomal squalene synthase (SQS) in vitro. These modifications were well tolerated for compounds with the 4,6-dimethyloctenoate ester at C-6 (S1 series). However in analogues without the C-6 ester (H1 series), removal of the C-4 hydroxy group gave compounds with reduced potency, whereas decarboxylation at C-3 resulted in a dramatic loss of SQS inhibitory activity. In comparison with S1 1, C-4 deoxyS1 3 and C-3 decarboxyS1 10 have shorter in vivo durations of action on the inhibition of hepatic cholesterol biosynthesis in rats. C-4 deoxyS1 3 retains good serum cholesterol-lowering ability in marmosets, while C-3 decarboxyS1 10 showed only a marginal effect even at high dose.

Disseminated, multiclonal Epstein-Barr virus-associated lymphoproliferative disease in a patient with hematological and immunological anomalies. Molecular analysis correlates with morphological appearance.

We report a case of a 21-year-old woman with hematopoietic, immunological, and congenital dysmorphic abnormalities, who died following rapidly progressive, disseminated Epstein-Barr virus (EBV)-associated lymphoproliferative disease (LPD). Polymerase chain reaction (PCR) amplification of formalin-fixed paraffin-embedded tissue showed differences in the clonality of each separate lymphoproliferative lesion examined, as determined by immunoglobulin heavy chain (IgH) gene rearrangement. PCR analysis also demonstrated that all lesions contained EBV genome. Since DNA had been extracted from paraffin blocks, a direct comparison of morphology and clonality could be made in each individual lesion. The evidence from this study indicates that the monoclonal tumors arose de novo in multiple sites and that the polyclonal background observed in some lesions reflected a substantial concomitant inflammatory response.

Pharmacological effects of GR138950, a novel angiotensin AT1 receptor antagonist.

The antagonist activity of GR138950 (1-[[3-bromo-2-[2-[[(trifluoromethyl)sulphonyl]amino]phenyl]-5- benzofuranyl]methyl]-4-cyclopropyl-2-ethyl-1H-imidazole-5-carboxamide) was investigated at angiotensin AT1 receptors and AT2 receptors in vitro and on blood pressure in conscious rats. GR138950 suppressed and displaced angiotensin II (AII) concentration-effect curves in the rabbit isolated aorta (pKb approximately 9.0-9.7) but had no effect against phenylephrine or serotonin induced-contractions. GR138950 competed with [3H]-AII for angiotensin AT1 receptors in rat liver membranes (pKi = 9.09). GR138950 had no apparent affinity for angiotensin AT2 receptors (bovine cerebellum; pKi < 6.0). GR138950 (1 mg/kg i.a. and p.o.) inhibited pressor responses to AII, but not phenylephrine, in conscious normotensive rats. Parallel displacements in AII dose-response curves occurred without any reduction in the maximum response to AII. The antagonist activity of GR138950 lasted for up to 24 h. GR138950 (> 0.03 mg/kg i.a., > 0.3 mg/kg p.o.) significantly reduced diastolic blood pressure (DBP) in renal artery ligated hypertensive rats. DBP was reduced maximally, 5 to 7 h after administration and the antihypertensive effect of GR138950 lasted for up to 48 h. Daily administration (5 days) of GR138950 to renal artery ligated hypertensive rats produced a sustained reduction in DBP. Acute administration of GR138950 (1 mg/kg i.a.) also significantly reduced DBP in spontaneously hypertensive rats but not in normotensive rats. Heart rate was little changed in renal artery ligated hypertensive rats, normotensive rats and spontaneously hypertensive rats. These experiments demonstrate that GR138950 is a potent, selective and specific angiotensin AT1 receptor antagonist that is orally active and reduces DBP in conscious hypertensive rats.(ABSTRACT TRUNCATED AT 250 WORDS)

Genetic differentiation of Candida albicans strains by mixed-linker polymerase chain reaction.

Restriction fragment length polymorphisms (RFLPs) of C. albicans were visualized using a mixed-linker polymerase chain reaction (PCR) and a C. albicans-specific primer (C. albicans 1059-bp species-specific repeat sequence). The method produced 10-14 bands of between 200 and 1400 bp on agarose gel electrophoresis and ethidium bromide staining. It gave comparable results to Southern blot hybridization with good reproducibility and the time required for the production of typing profiles was reduced to less than 2 days.

Lymphoproliferative disease of donor origin arising in patients after orthotopic liver transplantation.

BACKGROUND: Lymphoproliferative disease is a well recognized complication of organ transplantation and in many cases is associated with Epstein-Barr virus (EBV) infection. It is widely though that posttransplantation lymphoproliferative disease (PTLPD) arises from recipient lymphoid cells. However, solid organ allografts are likely to include donor lymphoid tissue around or within the transplanted organ. Therefore, it is possible that transplanted donor lymphocytes may proliferate to form PTLPD: METHODS: The genetic origin of tumor cells was determined by microsatellite DNA fingerprinting using the polymerase chain reaction (PCR). Their EBV association and clonality were established by PCR amplification of DNA extracted from formalin fixed, paraffin embedded tissue using primers to conserved regions of the EBV genome and the immunoglobulin heavy chain gene, respectively. RESULTS: The authors have demonstrated two cases of lymphoproliferative disease that were derived from donor lymphocytes in orthotopic liver transplant recipients. In both cases, the proliferating cells were EBV DNA positive. Furthermore, the PTLPD was restricted to allograft tissue around the porta hepatis. However, the two cases differed in their clonal properties and response to treatment: one case was oligoclonal and regressed after antiviral therapy and a modest reduction of immunosuppression, whereas the other contained two clonal populations and was controlled only after treatment with antineoplastic chemotherapy. CONCLUSION: This study has demonstrated two cases of PTLPD that were derived from donor lymphoid tissue. Although both cases were associated with EBV and remained localized to allograft tissue, their clonality and response to therapy differed.

The diagnostic use of the polymerase chain reaction for the detection of Mycobacterium tuberculosis.

Detection of Mycobacterium tuberculosis by microscopy is difficult in specimens containing fewer than 10(4) bacteria/mL and growth in culture can take up to 6 wks. In this study the Polymerase Chain Reaction (PCR) was investigated as a rapid diagnostic technique for the detection of M. tuberculosis. The presence of DNA polymerase inhibitors in sputum specimens poses a potentially serious problem as false negative results can occur. In this study polymerase inhibitors were detected by inclusion of an internal plasmid control in each test. DNA from specimens in which the internal control failed to amplify was purified with a DNA binding matrix before retesting by PCR. A total of 169 sputum specimens were examined and 4 were found to have inhibitors. The correlation between detection of M. tuberculosis by PCR with a combination of culture, Ziehl-Neelsen (ZN) staining and patient history was 97.6%. This study confirms that PCR offers a more sensitive and rapid alternative for the detection of M. tuberculosis to ZN staining and culture, with results being available within 24 hrs of a specimen being received in the laboratory.

Bromobenzofuran-based non-peptide antagonists of angiotensin II: GR138950, a potent antihypertensive agent with high oral bioavailability.

We have identified GR138950, a potent antagonist of the angiotensin II receptor with high oral bioavailability, as our second drug candidate to GR117289. Using GR117289, a compound with moderate bioavailability (20%) in man as a lead, we pursued a strategy aimed at enhancing bioavailability. The strategy was based on SAR established around the diacid GR117289, and from this, it was proposed that a monoacid, in particular a trifluoromethanesulfonamide, should be better absorbed after oral administration and have enhanced oral bioavailability. This led to the identification of GR138950, a potent antihypertensive agent in the renal hypertensive rat, causing sustained falls in blood pressure after oral administration. Oral bioavailability of GR138950 in rats and dogs is high, confirming that GR138950 is well absorbed after oral administration. Moreover, the low plasma clearance and long plasma half-life suggest that this compound will be suitable for once a day administration. Furthermore, the preliminary data indicate that the high bioavailability of GR138950 seen in rats and dogs translates to man. These results demonstrate clearly that GR138950 has the potential to be a clinically effective antihypertensive agent. Further studies are in progress to evaluate GR138950 in the treatment of hypertension.

Genotype and phenotype of oral Candida albicans from patients infected with the human immunodeficiency virus.

Candida albicans has been shown to vary in its phenotypic expression with the progression of human immunodeficiency virus (HIV) infection. Isolates of C. albicans were obtained from 45 patients with HIV infection during the progression of their disease and differentiated using two methods. The first utilized the morphological characteristics of colonies, and the second method utilized a small portion of C. albicans DNA as a probe on Southern-transferred, EcoRI-digested C. albicans genomic DNA. In 67% of the patients a single strain of C. albicans, as determined by the DNA analysis, was isolated from each individual. The phenotypic expression of the genetically identical strains varied considerably over the experimental period with one morphotype being predominant. These results showed that the genotype of C. albicans persisted in the majority of HIV-infected individuals, but that the phenotypical expression of this strain changed. A novel finding in this study was that 18 strains of C. albicans had DNA which did not hybridize to the probe used.

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients.

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

Cardiovascular effects of GR117289, a novel angiotensin AT1 receptor antagonist.

1. The effect of GR117289, an angiotensin AT1 receptor antagonist, on diastolic blood pressure (DBP) was determined in angiotensin-dependent and angiotensin-independent models of hypertension in rats. In addition, the antagonist profile of GR117289 at angiotensin AT1 receptors was determined in conscious renal hypertensive rats and conscious normotensive rats, dogs and marmosets. 2. Intra-arterial and oral administration of GR117289 (0.3-3 mg kg-1, i.a.; 1-10 mg kg-1, p.o.) to 6-day left renal artery ligated hypertensive (RALH) rats (DBP > 140 mmHg) produced significant, dose-related reductions in DBP with little apparent effect on heart rate (< 15%). The antihypertensive effect of GR117289 developed progressively over several hours and with some doses persisted for 24-48 h after administration. 3. Administration of GR117289 (1 mg kg-1, i.a.) on 5 consecutive days to RALH rats reduced DBP on each day. The antihypertensive effect of GR117289 was not cumulative as DBP had almost returned to base-line values, 24 h after administration of each dose. 4. A dose of GR117289 (3 mg kg-1, i.a.), which produced a substantial reduction in DBP (about 70 mmHg) in RALH rats, was administered to rats in which blood pressure was elevated either by unilateral renal artery clipping, sustained infusion of angiotensin II (AII), DOCA-salt administration or genetic inbreeding. GR117289 reduced DBP in rats in which the renin-angiotensin system was activated by renal artery clipping or AII infusion but had little effect in normotensive rats, DOCA-salt rats and SHR. 5. Systemic administration of All to RALH rats and to normotensive rats, dogs and marmosets elicited reproducible pressor responses in all species. Systemic or oral administration of GR1 17289 (3 mg kg-1)inhibited the pressor responses produced by All, resulting in parallel, rightward displacements of All dose-response curves.6. Maximal displacements of All dose-response curves occurred 1 h and 1-7 h after systemic and oral administration, respectively. GR1 17289 produced a 32-246 fold displacement after systemic administration and a 4-12 fold displacement after oral administration. The effect in dogs was short lasting after systemic administration but the effect of GRI17289 lasted for up to 24 h in rats and marmosets and for up to 24 h after oral administration in all species. The antagonist activity appeared specific for angiotensin receptors as GRi17289 did not inhibit pressor responses to phenylephrine or vasopressin.7. These experiments demonstrate that GRI 17289 reduces blood pressure in conscious hypertensive rats after both systemic and oral administration, and is an effective antagonist at angiotensin AT1 receptors in conscious rats, dogs and marmosets.